ID: 1190616443_1190616446

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1190616443 1190616446
Species Human (GRCh38) Human (GRCh38)
Location X:52238526-52238548 X:52238542-52238564
Sequence CCTGTTTGATGTTTTCTGAGCTT TGAGCTTCTTGGACCCATGTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 39, 3: 172, 4: 564} {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!