ID: 1190620119_1190620122

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1190620119 1190620122
Species Human (GRCh38) Human (GRCh38)
Location X:52278882-52278904 X:52278895-52278917
Sequence CCTGGTTGACCCTTAAAGCCTGT TAAAGCCTGTATCTCGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 6, 4: 80} {0: 1, 1: 0, 2: 1, 3: 8, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!