|
Left Crispr |
Right Crispr |
| Crispr ID |
1190622101 |
1190622106 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
X:52297685-52297707
|
X:52297717-52297739
|
| Sequence |
CCACATGTTCTCACTCATAGGTG |
CAATTGGAACACATGGACCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8120, 1: 14274, 2: 8213, 3: 6298, 4: 4752} |
{0: 1, 1: 5, 2: 433, 3: 15917, 4: 18143} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|