ID: 1190623566_1190623570

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1190623566 1190623570
Species Human (GRCh38) Human (GRCh38)
Location X:52313644-52313666 X:52313682-52313704
Sequence CCATGTTTCCTGCTGATCAACAG TTCCCTCCACAGCAACCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 198} {0: 1, 1: 0, 2: 1, 3: 29, 4: 762}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!