ID: 1190628399_1190628404

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1190628399 1190628404
Species Human (GRCh38) Human (GRCh38)
Location X:52359930-52359952 X:52359955-52359977
Sequence CCTAAATTTGCATTAACCCGCCC AATATACACGTAATTGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 27, 4: 78} {0: 1, 1: 1, 2: 8, 3: 54, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!