ID: 1190646975_1190646981

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1190646975 1190646981
Species Human (GRCh38) Human (GRCh38)
Location X:52531662-52531684 X:52531678-52531700
Sequence CCCTGCTCCATCATTTTCTGTAG TCTGTAGAGCAGGGCCAAGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 30, 4: 300} {0: 2, 1: 0, 2: 4, 3: 20, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!