ID: 1190650953_1190650959

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1190650953 1190650959
Species Human (GRCh38) Human (GRCh38)
Location X:52568280-52568302 X:52568302-52568324
Sequence CCCCGAACAAAGGGATCAATCAC CCTTTTAAGTAGTTTGTGGCGGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 1, 3: 6, 4: 84} {0: 2, 1: 4, 2: 6, 3: 27, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!