ID: 1190650998_1190651001

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1190650998 1190651001
Species Human (GRCh38) Human (GRCh38)
Location X:52568689-52568711 X:52568705-52568727
Sequence CCACTTTGGTGCTTGCCATACAT CATACATGCAGATTAATAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148} {0: 1, 1: 0, 2: 0, 3: 29, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!