ID: 1190655965_1190655972

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1190655965 1190655972
Species Human (GRCh38) Human (GRCh38)
Location X:52612367-52612389 X:52612403-52612425
Sequence CCCGCCTCAGCTTAGGGACTACA CTGCCTTTTGCTATGTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 242} {0: 1, 1: 0, 2: 2, 3: 24, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!