ID: 1190679394_1190679402

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1190679394 1190679402
Species Human (GRCh38) Human (GRCh38)
Location X:52811763-52811785 X:52811792-52811814
Sequence CCGCCACCCCAAGGTTTGTATAA GCAGAGGTGCCCGCCCGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 151} {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!