ID: 1190681737_1190681744

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1190681737 1190681744
Species Human (GRCh38) Human (GRCh38)
Location X:52831680-52831702 X:52831709-52831731
Sequence CCAGGCAGCCAATCCCAGAGACC TGGACTTGTGGTGCCTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 537, 3: 310, 4: 371} {0: 2, 1: 13, 2: 66, 3: 102, 4: 2347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!