ID: 1190708407_1190708413

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1190708407 1190708413
Species Human (GRCh38) Human (GRCh38)
Location X:53048915-53048937 X:53048936-53048958
Sequence CCCAACCTGGGGCTCTCCCAGGC GCCATGGCCCGTGTGCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 344} {0: 1, 1: 0, 2: 3, 3: 10, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!