ID: 1190735784_1190735791

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1190735784 1190735791
Species Human (GRCh38) Human (GRCh38)
Location X:53255402-53255424 X:53255455-53255477
Sequence CCTTCCAGTTTTTTCCTATATGT TAGCCAAACAATCTATTGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 421} {0: 1, 1: 0, 2: 1, 3: 14, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!