ID: 1190736485_1190736490

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1190736485 1190736490
Species Human (GRCh38) Human (GRCh38)
Location X:53258729-53258751 X:53258758-53258780
Sequence CCTGAAATCTCCTGCTGAGGCAG CACTTGAATCCAGGAGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 23, 4: 240} {0: 565, 1: 11436, 2: 38258, 3: 80519, 4: 117718}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!