ID: 1190738156_1190738164

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1190738156 1190738164
Species Human (GRCh38) Human (GRCh38)
Location X:53269374-53269396 X:53269413-53269435
Sequence CCTCTGTAAGAAAGAGGGGGCCC CAGTCTCTCCACCTGGACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 106} {0: 1, 1: 1, 2: 1, 3: 32, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!