ID: 1190745751_1190745763

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1190745751 1190745763
Species Human (GRCh38) Human (GRCh38)
Location X:53321051-53321073 X:53321083-53321105
Sequence CCAGCAGGTACTCCACGGCCCGA TCGGATCCCGGGCCGCCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66} {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!