ID: 1190760453_1190760465

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1190760453 1190760465
Species Human (GRCh38) Human (GRCh38)
Location X:53433937-53433959 X:53433965-53433987
Sequence CCCACGCTGTCGCCTGCCTGTTC GCTTCTGAGGAGAAGGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 754} {0: 1, 1: 1, 2: 1, 3: 51, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!