ID: 1190765957_1190765967

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1190765957 1190765967
Species Human (GRCh38) Human (GRCh38)
Location X:53475826-53475848 X:53475872-53475894
Sequence CCACCAGGTAAGAACCATAGCCA AGGGAGTATGGAATGGCTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 6, 3: 27, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!