ID: 1190776948_1190776961

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1190776948 1190776961
Species Human (GRCh38) Human (GRCh38)
Location X:53560333-53560355 X:53560384-53560406
Sequence CCAGTGTCAGAGAACTGTGGTCT TAGGGATATTTCCTGGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 167} {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!