|
Left Crispr |
Right Crispr |
| Crispr ID |
1190778799 |
1190778804 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
X:53577542-53577564
|
X:53577561-53577583
|
| Sequence |
CCTTCCATGGTCTCCCTCTGATG |
GATGCCGAGCCAAAGCTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 89, 2: 14, 3: 27, 4: 216} |
{0: 54, 1: 81, 2: 38, 3: 20, 4: 170} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|