ID: 1190806796_1190806800

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1190806796 1190806800
Species Human (GRCh38) Human (GRCh38)
Location X:53845399-53845421 X:53845442-53845464
Sequence CCTGAGTTTTATCATAACTTGAA TCCTATTTAAATATCCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 535} {0: 1, 1: 0, 2: 3, 3: 8, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!