ID: 1190832581_1190832586

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1190832581 1190832586
Species Human (GRCh38) Human (GRCh38)
Location X:54072676-54072698 X:54072724-54072746
Sequence CCAAAGCTAGAGCTTTTCTATAG CTGACAGCTACTGCCTTACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132} {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!