ID: 1190962249_1190962259

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1190962249 1190962259
Species Human (GRCh38) Human (GRCh38)
Location X:55264424-55264446 X:55264463-55264485
Sequence CCGCAGTGTTCCTAGTTTCCAGG CACCTCGCCCTGCCACTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 243} {0: 1, 1: 0, 2: 4, 3: 56, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!