ID: 1190980398_1190980402

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1190980398 1190980402
Species Human (GRCh38) Human (GRCh38)
Location X:55452454-55452476 X:55452470-55452492
Sequence CCTCAGAGGCCTCCGAGACCCCT GACCCCTATGGCCGCCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 246} {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!