ID: 1190996745_1190996751

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1190996745 1190996751
Species Human (GRCh38) Human (GRCh38)
Location X:55617465-55617487 X:55617499-55617521
Sequence CCACCAAAGCCCAGTAACAGGTC AGTTATCTACAGAAGATGGCAGG
Strand - +
Off-target summary {0: 7, 1: 150, 2: 161, 3: 101, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!