ID: 1190996745_1190996752

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1190996745 1190996752
Species Human (GRCh38) Human (GRCh38)
Location X:55617465-55617487 X:55617500-55617522
Sequence CCACCAAAGCCCAGTAACAGGTC GTTATCTACAGAAGATGGCAGGG
Strand - +
Off-target summary No data {0: 7, 1: 193, 2: 174, 3: 139, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!