ID: 1191031247_1191031254

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1191031247 1191031254
Species Human (GRCh38) Human (GRCh38)
Location X:55975264-55975286 X:55975285-55975307
Sequence CCCTGAAGAGAGAATGCATTTGG GGCATGTTGGGAGGATTTAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!