ID: 1191101680_1191101690

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1191101680 1191101690
Species Human (GRCh38) Human (GRCh38)
Location X:56736346-56736368 X:56736378-56736400
Sequence CCTCCGCCCCCCGGGGTCAAGCA CCGCAGCCTCCCAAACAGCTGGG
Strand - +
Off-target summary {0: 2, 1: 54, 2: 5894, 3: 39427, 4: 107231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!