ID: 1191101685_1191101697

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1191101685 1191101697
Species Human (GRCh38) Human (GRCh38)
Location X:56736355-56736377 X:56736405-56736427
Sequence CCCGGGGTCAAGCAATTCTCCTG CCGGTGCCCGCCACCATGCCCGG
Strand - +
Off-target summary {0: 126, 1: 32908, 2: 107859, 3: 219522, 4: 216011} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!