ID: 1191103508_1191103511

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1191103508 1191103511
Species Human (GRCh38) Human (GRCh38)
Location X:56758387-56758409 X:56758402-56758424
Sequence CCATCCAGCAGAACAGGGTCGAG GGGTCGAGAAAGGCATCTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102} {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!