ID: 1191108615_1191108621

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1191108615 1191108621
Species Human (GRCh38) Human (GRCh38)
Location X:56788242-56788264 X:56788291-56788313
Sequence CCTTCCTCTTTATTCACATGGGA AGCAAGGTTATGGTTGTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!