ID: 1191161451_1191161452

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1191161451 1191161452
Species Human (GRCh38) Human (GRCh38)
Location X:57333943-57333965 X:57333957-57333979
Sequence CCTTATCTGTAGAAGAGCAAAGA GAGCAAAGACAGAATTATATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!