ID: 1191204849_1191204860

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1191204849 1191204860
Species Human (GRCh38) Human (GRCh38)
Location X:57822813-57822835 X:57822866-57822888
Sequence CCATGTGCAGTGGAAAAGCAGTT TCTGATTTGCATAGGGTCCAGGG
Strand - +
Off-target summary No data {0: 4, 1: 27, 2: 137, 3: 149, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!