ID: 1191210373_1191210377

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1191210373 1191210377
Species Human (GRCh38) Human (GRCh38)
Location X:57878223-57878245 X:57878269-57878291
Sequence CCTGTTGCTGCACACATCTATGC TGATGCAGAAAACAAAAAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 6, 3: 89, 4: 871}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!