ID: 1191220765_1191220773

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1191220765 1191220773
Species Human (GRCh38) Human (GRCh38)
Location X:57985727-57985749 X:57985755-57985777
Sequence CCAATGCCAAGCTTTCCCAGCTG TGCCCTGCAGCGGGCCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 233} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!