ID: 1191255306_1191255325

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1191255306 1191255325
Species Human (GRCh38) Human (GRCh38)
Location X:58277090-58277112 X:58277142-58277164
Sequence CCGGCCTCCTCAACCTTTCCCTG GGGGACTTCTTGCTGCTTTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!