ID: 1191670563_1191670577

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1191670563 1191670577
Species Human (GRCh38) Human (GRCh38)
Location X:63744975-63744997 X:63745018-63745040
Sequence CCCAATGCCAAGGCACCTACTCC CACAATTCACAGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 120} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!