ID: 1191712005_1191712012

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1191712005 1191712012
Species Human (GRCh38) Human (GRCh38)
Location X:64159922-64159944 X:64159936-64159958
Sequence CCTCACAGTAAACCTAGTGGCTA TAGTGGCTAAGGAGGGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 66, 4: 672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!