ID: 1191715851_1191715856

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1191715851 1191715856
Species Human (GRCh38) Human (GRCh38)
Location X:64193036-64193058 X:64193057-64193079
Sequence CCTTTCCCAGAACCTTTGCTCCG CGTCCCCCTCCAAAGAAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179} {0: 1, 1: 0, 2: 0, 3: 14, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!