ID: 1191769275_1191769281

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1191769275 1191769281
Species Human (GRCh38) Human (GRCh38)
Location X:64738410-64738432 X:64738455-64738477
Sequence CCAGCAAACACTGTAATTCCCTT AGGAGGAGCCCAAAGTGTCCAGG
Strand - +
Off-target summary No data {0: 114, 1: 227, 2: 161, 3: 144, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!