ID: 1191769492_1191769500

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1191769492 1191769500
Species Human (GRCh38) Human (GRCh38)
Location X:64740081-64740103 X:64740129-64740151
Sequence CCACTAAAGCCCAGTAACAGGCC AGTTATTTGCAGAAGAAGGCAGG
Strand - +
Off-target summary {0: 7, 1: 155, 2: 166, 3: 94, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!