ID: 1191824779_1191824783

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1191824779 1191824783
Species Human (GRCh38) Human (GRCh38)
Location X:65353106-65353128 X:65353134-65353156
Sequence CCGGCCTCCTTCTTAGTGCTCAG AGACATGATCCACTGTGTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 18, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!