|
Left Crispr |
Right Crispr |
| Crispr ID |
1191842543 |
1191842547 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
X:65523583-65523605
|
X:65523597-65523619
|
| Sequence |
CCAGCAAGGTGAGCCCAAGCAGG |
CCAAGCAGGACTCAACCATCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 14, 4: 177} |
{0: 1, 1: 0, 2: 2, 3: 11, 4: 395} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|