ID: 1191842543_1191842549

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1191842543 1191842549
Species Human (GRCh38) Human (GRCh38)
Location X:65523583-65523605 X:65523599-65523621
Sequence CCAGCAAGGTGAGCCCAAGCAGG AAGCAGGACTCAACCATCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177} {0: 1, 1: 0, 2: 1, 3: 3, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!