ID: 1192034128_1192034134

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1192034128 1192034134
Species Human (GRCh38) Human (GRCh38)
Location X:67545395-67545417 X:67545408-67545430
Sequence CCCCAGGCAGCAGCAGCAGCAGC CAGCAGCAGCAGGGTGAGGATGG
Strand - +
Off-target summary {0: 4, 1: 11, 2: 114, 3: 470, 4: 1543} {0: 1, 1: 0, 2: 12, 3: 131, 4: 933}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!