ID: 1192080767_1192080771

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1192080767 1192080771
Species Human (GRCh38) Human (GRCh38)
Location X:68045839-68045861 X:68045860-68045882
Sequence CCACAAACCACAAGGTCCCTTGC GCTAGATAAGTGTGATATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125} {0: 1, 1: 0, 2: 2, 3: 10, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!