ID: 1192081674_1192081685

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1192081674 1192081685
Species Human (GRCh38) Human (GRCh38)
Location X:68053719-68053741 X:68053759-68053781
Sequence CCGGCAGGGAGGATCTGGGGGCC ATGGTTGGCTTTTCTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 332} {0: 1, 1: 0, 2: 2, 3: 19, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!