ID: 1192140846_1192140854

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1192140846 1192140854
Species Human (GRCh38) Human (GRCh38)
Location X:68646475-68646497 X:68646518-68646540
Sequence CCAGGGTCCCAGGACCTGGCTGT TCTGAAACAGAAGTGAGGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 37, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!