ID: 1192153176_1192153187

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1192153176 1192153187
Species Human (GRCh38) Human (GRCh38)
Location X:68724437-68724459 X:68724459-68724481
Sequence CCAGGGTGGCACCACCCAGGCCC CCCTGGGCACCAAGGGAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 305} {0: 1, 1: 0, 2: 0, 3: 41, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!