ID: 1192168723_1192168727

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1192168723 1192168727
Species Human (GRCh38) Human (GRCh38)
Location X:68841581-68841603 X:68841594-68841616
Sequence CCACCCTGTTCTCTCCTTACCTT TCCTTACCTTTGGCATCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 767} {0: 1, 1: 0, 2: 0, 3: 9, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!